Transcription: from DNA to messenger RNA
Grade 9 Science Worksheet - Challenge Me
Circle the best answer.
Ari reads a model pre-mRNA. The introns are cut out and the exons are joined. How many bases are in the mature mRNA?
- 60 bases
- 27 bases
- 33 bases
- 45 bases
Bo reads a second model pre-mRNA. Three bases make one codon. How many codons are in the mature mRNA?
- 36 codons
- 19 codons
- 17 codons
- 57 codons
Read this first
Model rate card (model data)
fact value bases added each second by E. coli RNA polymerase 40 codons in the model mRNA 400 bases in one codon 3 Esme reads a rate card. About how many seconds does the polymerase need to build the whole model mRNA?
- 1,240 seconds
- 48,000 seconds
- 30 seconds
- 10 seconds
Use this
Model gene (not to scale).
Jun reads a model template. RNA polymerase builds a pre-mRNA from it, and then the intron is cut out. Which mature mRNA is left?
- ATGACATTCGAC
- AUGACAUUCGAC
- AUGACAGUAAAGUUCGAC
- UACUGUAAGCUG
Kira reads a model template. Two introns are cut out of the pre-mRNA built from it. Which mature mRNA is left?
- GUACAGGUCCAG
- AUGCCGACUUCGAAC
- AUGCCGACUUGUCCAGCGAAC
- ATGCCGACTTCGAAC
Notebook on a plant cell’s mRNA (model data)
line what it says 1 Transcription of a gene takes place in the nucleus 2 A cap is added at the 5′ end and a poly-A tail at the 3′ end 3 Introns are cut out and the exons are joined 4 The finished mRNA keeps its introns when it leaves the nucleus Noah checks a classmate’s notebook on a plant cell’s mRNA. Exactly one line is wrong. Which line, and why?
- Line 1, because transcription takes place in the cytoplasm
- Line 3, because the exons are the parts cut out
- Line 4, because introns are cut out in the nucleus
- Line 2, because the cap and tail are added to the DNA
Use this
Notebook on strands and direction (model data), 4 rows. Columns: line, what it says. 1, The DNA opens in front of the moving polymerase and closes again behind it. 2, RNA polymerase builds the mRNA from its 5′ end toward its 3′ end. 3, The mRNA matches the coding strand, with U where the DNA has T. 4, One gene is read from both of its strands, so two mRNAs form.
Pia checks a classmate’s notebook on strands and direction. Exactly one line is wrong. Which line, and why?
- Line 4, because one strand is the template for a gene
- Line 2, because the mRNA is built from its 3′ end
- Line 1, because the DNA stays open behind the polymerase
- Line 3, because the mRNA has the same letters as the template
Two cells card (model data)
cell has a nucleus bacterial cell no plant cell yes Ren compares a bacterial cell and a plant cell. Which claim and reason are correct?
- In the bacterial cell, a ribosome must wait for the finished mRNA, because the DNA is kept in a nucleus
- In the plant cell, a ribosome can start reading the mRNA during its building, because transcription takes place in the cytoplasm
- In the plant cell, a ribosome reads the pre-mRNA with its introns, because splicing is not needed
- In the bacterial cell, a ribosome can start reading the mRNA during its building, because there is no nucleus
Where things are in a plant cell (model data)
structure where it is DNA nucleus ribosomes cytoplasm Tala asks how a gene in a plant cell’s DNA can direct a protein built at a ribosome. Which claim and reason are correct?
- The DNA moves to the cytoplasm, because ribosomes read DNA
- The mRNA copy is built in the cytoplasm, because the ribosomes are there
- A copy of both strands leaves the nucleus, because the ribosome needs the double helix
- The mRNA copy of one strand leaves the nucleus, because the DNA stays inside
Model template (not to scale). Zee predicts the coding strand and the mRNA for this template. Which claim and reason are correct?
- Coding strand CATGGA and mRNA CATGGA, because RNA keeps T like DNA
- Coding strand CATGGA and mRNA CAUGGA, because U replaces T
- Coding strand GTACCT and mRNA GUACCU, because both copy the template
- Coding strand CATGGA and mRNA GUACCU, because the mRNA pairs with it