Transcription: from DNA to messenger RNA

Grade 9 Science Worksheet - Challenge Me

Circle the best answer.

1. 1.

   Ari reads a model pre-mRNA. The introns are cut out and the exons are joined. How many bases are in the mature mRNA?

   • 27 bases
   • 33 bases
   • 60 bases
   • 45 bases
2. 2.

   Bo reads a second model pre-mRNA. Three bases make one codon. How many codons are in the mature mRNA?

   • 19 codons
   • 36 codons
   • 57 codons
   • 17 codons

3. Read this first

   Model rate card (model data)

   fact	value
   bases added each second by E. coli RNA polymerase	40
   codons in the model mRNA	400
   bases in one codon	3

4. 3.

   Esme reads a rate card. About how many seconds does the polymerase need to build the whole model mRNA?

   • 48,000 seconds
   • 10 seconds
   • 30 seconds
   • 1,240 seconds
5. 4.

   Model gene (not to scale). Kira reads a model template. Two introns are cut out of the pre-mRNA built from it. Which mature mRNA is left?

   • AUGCCGACUUCGAAC
   • ATGCCGACTTCGAAC
   • GUACAGGUCCAG
   • AUGCCGACUUGUCCAGCGAAC

6. Use this

   Notebook on transcription (model data), 4 rows. Columns: line, what it says. 1, RNA polymerase reads the template strand of one gene. 2, The mRNA is built by pairing bases with the template. 3, Compared with the coding strand, the mRNA has U where the DNA has T. 4, The mRNA has the same letters as the template strand.

7. 5.

   Milo checks a classmate’s notebook on transcription. Exactly one line is wrong. Which line, and why?

   • Line 1, because both strands of a gene are read
   • Line 3, because RNA keeps T like DNA
   • Line 2, because mRNA is built from the coding strand
   • Line 4, because the mRNA pairs with the template

8. Notebook on a plant cell’s mRNA (model data)

   line	what it says
   1	Transcription of a gene takes place in the nucleus
   2	A cap is added at the 5′ end and a poly-A tail at the 3′ end
   3	Introns are cut out and the exons are joined
   4	The finished mRNA keeps its introns when it leaves the nucleus

9. 6.

   Noah checks a classmate’s notebook on a plant cell’s mRNA. Exactly one line is wrong. Which line, and why?

   • Line 3, because the exons are the parts cut out
   • Line 4, because introns are cut out in the nucleus
   • Line 1, because transcription takes place in the cytoplasm
   • Line 2, because the cap and tail are added to the DNA

10. Use this

    Notebook on strands and direction (model data), 4 rows. Columns: line, what it says. 1, The DNA opens in front of the moving polymerase and closes again behind it. 2, RNA polymerase builds the mRNA from its 5′ end toward its 3′ end. 3, The mRNA matches the coding strand, with U where the DNA has T. 4, One gene is read from both of its strands, so two mRNAs form.

11. 7.

    Pia checks a classmate’s notebook on strands and direction. Exactly one line is wrong. Which line, and why?

    • Line 2, because the mRNA is built from its 3′ end
    • Line 1, because the DNA stays open behind the polymerase
    • Line 3, because the mRNA has the same letters as the template
    • Line 4, because one strand is the template for a gene

12. Two cells card (model data)

    cell	has a nucleus
    bacterial cell	no
    plant cell	yes

13. 8.

    Ren compares a bacterial cell and a plant cell. Which claim and reason are correct?

    • In the bacterial cell, a ribosome must wait for the finished mRNA, because the DNA is kept in a nucleus
    • In the bacterial cell, a ribosome can start reading the mRNA during its building, because there is no nucleus
    • In the plant cell, a ribosome can start reading the mRNA during its building, because transcription takes place in the cytoplasm
    • In the plant cell, a ribosome reads the pre-mRNA with its introns, because splicing is not needed

14. Where things are in a plant cell (model data)

    structure	where it is
    DNA	nucleus
    ribosomes	cytoplasm

15. 9.

    Tala asks how a gene in a plant cell’s DNA can direct a protein built at a ribosome. Which claim and reason are correct?

    • A copy of both strands leaves the nucleus, because the ribosome needs the double helix
    • The DNA moves to the cytoplasm, because ribosomes read DNA
    • The mRNA copy of one strand leaves the nucleus, because the DNA stays inside
    • The mRNA copy is built in the cytoplasm, because the ribosomes are there
16. 10.

    Model template (not to scale). Zee predicts the coding strand and the mRNA for this template. Which claim and reason are correct?

    • Coding strand CATGGA and mRNA CATGGA, because RNA keeps T like DNA
    • Coding strand CATGGA and mRNA CAUGGA, because U replaces T
    • Coding strand GTACCT and mRNA GUACCU, because both copy the template
    • Coding strand CATGGA and mRNA GUACCU, because the mRNA pairs with it